Py4Bio Chapter 11: Intro to BioPython

This is the Chapter 11 of Py4Bio.

Biopython is a library for the Python programming language.

Package that assists with processing biological data.

এই সেপ্টেম্বর Oxford BioDiscovery-তে আমার Metagenomics and Amplicon Sequence Analysis লাইভ অনলাইন কোর্স শুরু হবে। বিস্তারিত জানতে ক্লিক করুন।

Consists of several modules – some with common operations, some more specialized.

But before learning more about BioPython, let’s get some idea about Object Oriented Programming (OOP).

Biopython is object-oriented. So, some knowledge helps understand how biopython work.

Object Oriented Programming

OOP is a way of organizing data and methods that work on them in a coherent package. OOP helps structure and organize the code.

Classes and objects

A class:

  • is a user defined type 
  • is a mold for creating objects
  • specifies how an object can contain and process data
  • represents an abstraction or a template for how an object of that class will behave

An object is an instance of a class.

All objects have a type – shows which class they were made from.

Attributes and methods

Class and Instances

Class and object example

Class: Seq

Seq has:

  • attribute length
  • method translate

An object of the class Seq is created like this:

myseq = Seq(“ATGGCCG”)

Get sequence length:

myseq.length

Get sequence translation:

myseq.translate()

OOP Summary

An object has to be instantiated, i.e. created, to exist.

Every object has a certain type, i.e. is of a certain class.

The class decides which attributes and methods an object has.

Attributes and methods are accessed using . after the object variable name.

Explaining OOP with BioPython

You can install BioPython from here.

With time, you will come to know many other packages. It’s a good idea to familiarize yourself with the documentation of that package. For example, BioPython documentation can be found here.

Test your BioPython installation:

>>> import Bio
>>> print(Bio.__version__)

Biopython functionality and tools

Tools to parse bioinformatics files into Python data structures

Supports the following formats

  • BLAST, Clustalw, FASTA
  • PubMed and Medline
  • ExPASy files
  • SwissProt, PDB

Files in the supported formats can be iterated over record by record or indexed and accessed via a dictionary interface.

Seq object

Represents one sequence. It has following methods:

  • translate()
  • transcribe()
  • complement()
  • reverse_complement()

>>> from Bio.Seq import Seq
>>> my_seq = Seq("AGTACACTGGT")

>>> my_seq
Seq('AGTACACTGGT')


>>> my_seq.translate()
Seq('STL')
>>> my_seq.transcribe()
Seq('AGUACACUGGU')
>>> my_seq.complement()
Seq('TCATGTGACCA')

What is happening here?

from Bio.Seq import Seq

Bio and Seq are packages.

Packages contain modules.

We are importing Seq module from the Seq package.

Modules are essentially individual Python file.

Seq module contains class Seq()

We are making an instance of Seq() class in my_seq variable.

translate, transcribe, complements are methods defined in Seq() class.

We are calling those methods for my_seq instance we just created.

Few more examples with Seq

All transcribe() does is a switch T –> U. lThe Seq object also includes a back-transcription method.

from Bio.Seq import Seq

coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")

messenger_rna = coding_dna.transcribe()
cDNA = messenger_rna.back_transcribe()

print(coding_dna)
print(messenger_rna)
print(cDNA)

Seq as a string

Most string methods work on Seqs

If string is needed, do str(seq)

>>> seq = Seq('CCGGGTTAACGTA')

>>> seq[:5]
Seq('CCGGG', IUPACUnambiguousDNA())
>>> len(seq)
13

>>> seq.lower()
Seq('ccgggttaacgta', DNAAlphabet())
>>> print(seq)
CCGGGTTAACGTA
>>> list(seq)
['C', 'C', 'G', 'G', 'G', 'T', 'T', 'A', 'A', 'C', 'G', 'T', 'A']

>>> mystring = str(seq)
>>> print(mystring)
CCGGGTTAACGTA

>>> type(seq)
<class 'Bio.Seq.Seq'>
>>> type(mystring)
<type 'str'>

Introduction to SeqRecord

Seq contains the sequence. But sequences often come with a lot more.

SeqRecord = Seq + metadata

Main attributes: ID and Seq

But it may have additional attributes:

  • name – Sequence name, e.g. gene name (string)
  • description – Additional text, imagine fasta description (string)
  • dbxrefs – List of database cross references (list of strings)
  • features – Any (sub)features defined (list of SeqFeature objects)
  • annotations – Further information about the whole sequence (dictionary)   Most entries are strings, or lists of strings.
from Bio.SeqRecord import SeqRecord
from Bio.Seq import Seq

seq = Seq('CCGGGTTAACGTA')
seq_record_1 = SeqRecord(seq, id='01')

print(seq_record_1)

# Or,
seq_record_1 = SeqRecord(seq)
seq_record_1.id = "01"
seq_record_1.descrption = "toxic membrane protein"

print(seq_record_1)

# Or,
#another way to define a Seq Record
seq_record_1 =
SeqRecord(Seq('CCGGGTTAACGTA'), id = 'YP_025292.1', name='HokC', description='toxic membrane protein',dbxrefs=[])

print(seq_record_1)

SeqIO: Another important module of BioPython

We will never type sequence in a program. We’ll read it from a file in different format (fasta, GenBank, etc.).

SeqIO provides tools to to retrieve sequences as SeqRecord, and can write SeqRecord to file.

Reading: parse(file_handle, format)

Writing: write(SeqRecords(s), file_handle, format)

Read/write common biological file formats:

  • FASTA, GenBank, EMBL
  • FASTQ (sequencing reads)
  • GFF, BED (genomic features)
  • PDB (protein structures)
  • PHYLIP, Nexus (phylogenetic data)
from Bio import SeqIO

SeqIO.parse()

Reads in sequence data as SeqRecord objects

It expects two arguments:

An object (called handle) to read the data. It can be:

  • a file opened for reading
  • the output from a command line program
  • data downloaded from the internet

A lower case string specifying the sequence format 

The object returned by SeqIO.parse() is an iterator which returns SeqRecord objects.

from Bio import SeqIO

file_handle = "P53.fasta" # notice we are not using open()

for seq_rec in SeqIO.parse(file_handle, "fasta"):
        print(seq_rec.id)
        print(seq_rec.seq)
        print(len(seq_rec.seq))

Writing files

from Bio import SeqIO

seq_list = [ ... ] # this should be a list of SeqRecords

SeqIO.write(seq_list, "seq_list.fasta", "fasta")

Example Use Case: Fetching a sequence from NCBI

from Bio import Entrez, SeqIO

Entrez.email = "your@email.com"

handle = Entrez.efetch(db="nucleotide", 
id="NM_001301717", rettype="gb", retmode="text")

record = SeqIO.read(handle, "genbank")

print(record.description)

Exercise 1: Filtering DNA sequences

Input data: DNA sequencing reads  in FASTQ format in file sample1.fq

Problem: Write a script that:

1. reads  the sequences

2. writes  only those reads which 

  a) are  >= 200 bp  long 

  b) do not  contain any uncalled  bases (i.e. ‘N’ s) to an output file sample1_filtered.fq

Exercise 2: Calculate FASTQ stats

Input data: DNA sequences in FASTQ format from file reads.fq

Problem: Write a script that 

a) calculates  the following values for each read:

id, length, GC content, A count, T count, C count, G count, avg. quality

b) writes these as columns to a csv file (one row per read)  

Hints:

– You can use Bio.SeqUtils for calculating GC content and skew (check documentation!)

– Find base qualities for each record in record.letter_annotations[“phred_quality”]

Go to the index of Py4Bio.

Py4Bio Worksheets

I have created a set of worksheets that give a quick overview of Python for Bioinformatics (as well as intro to UNIX). You just have to give it 3-6 hours, and you will know the essentials!

Leave a Reply